The Polymorphism of the Alpha 2-macroglobulin (a2m) Gene and Its Role in Alzheimer Disease
Sponsored by Missouri Western State University Sponsored by a grant from the National Science Foundation DUE-97-51113
Home |
The proper APA Style reference for this manuscript is:
SCOTT, A.A. (2000). The Polymorphism of the Alpha 2-macroglobulin (a2m) Gene and Its Role in Alzheimer Disease. National Undergraduate Research Clearinghouse, 3. Available online at http://www.webclearinghouse.net/volume/. Retrieved February 5, 2012 .

The Polymorphism of the Alpha 2-macroglobulin (a2m) Gene and Its Role in Alzheimer Disease
ADRIENNE A. SCOTT
Missouri Western State University DEPARTMENT OF BIOLOGY

Sponsored by: TODD ECKDAHL (eckdahl@missouriwestern.edu)
ABSTRACT
Alzheimer Disease affects three to five million Americans. Most of these patients are elderly although there are increasing numbers of cases of early onset Alzheimer disease. The debilitating clinical symptoms, which are observed in Alzheimer patients, will be described. The complex mutation process will be outlined, which involves the beta-amyloid peptide protein production, and the polymorphism of the A2M gene will be diagramed. Alzheimer disease diagnosis is difficult to achieve. There are many mimicking disease processes which must be ruled out first. The difficulty in diagnosis is due to the limited availability of definitive testing procedures. There are some very interesting genetic tools which are presently employed and in the process of being explored for the future treatment of Alzheimer disease.

NATURE OF THE DISEASE
Alzheimer disease is, by far, the most common neurodegenerative disease. Three to five million Americans are affected by senile dementia of the Alzheimer type (Gozes et al., 1996). The deteriorations of neuronal cells cause memory loss, dysfunction, difficulty speaking, ambulation and performing `every day` tasks. Most patients are diagnosed by clinical symptoms of which include the comprehensive decline of memory, household duties and decisions. Some patients also experience sleep loss, anger, frustration, anxiety from leaving their home and hallucinations (Alzheimer Forum, 2000).Inheritance of this frustrating, debilitating disease has been found to have a dominance pattern of inheritance with important modifier, multifactoral genes. The most cases are symptomatic in older patients (Sjogren et al., 1952). Symptoms of Alzheimer disease are usually acute, within a three-year time span and usually around the age of 55 (Alzheimer Forum, 2000). Several diseases and conditions can mimic Alzheimer disease such as Parkinson`s disease, Huntington`s disease and multiple sclerosis. Several blood tests must be evaluated and other complex scenarios ruled out such as confusion induced by prescribed drugs or vitamins. At present, there is not a definitive test available for Alzheimer disease. There is a thought that specifying a test for an assay of iron binding protein p97 might aid in diagnosis (Alzheimer Forum, 2000). There is an interesting technique in development which involves the intranasal deposition of a fatty neuropeptide. (Gozes et al, 1996). The disease complex was named after Alois Alzheimer (1864-1915), a neuropathologist and clinical psychiatrist. Alzheimer isolated the demonstration of a disease of the cerebral cortex in one of his patients (Bogerts, 1993). Dr. Alzheimer observed the neuronal loss in the cerebral cortex along with the excessive accumulation of two types of abnormal fibrous proteins, which include the deposition of amyloid protein and the hyperphosphorylation of tau, which forms paired helical filaments (Tomita et al., 1997).This paper is concentrated on the alpha 2-macroglobulin (A2M) gene. This contributing gene mutation of Alzheimer disease is located on the locus, 17q23. (OMIM, 2000) There is continued work to identify all gene loci of Alzheimer disease. Genetic tests for Alzheimer disease include the following: Apolipoprotein E allele typing, which is the only commercially available genetic test. ApoE alleles: ApoE e2, AopE e3, and ApoE e4 are the most common alleles. (Alzheimer Forum, 2000)The entire etiology of Alzheimer disease is still unclear. The excessive accumulation of amyloid proteins, called beta-amyloid peptide proteins (APP) have been found in the diagnosis of Alzheimer disease (Glenner and Wong, 1984). As cited by Glenner and Wong (1984), The 4.2-kD polypeptide was called beta protein because of its partial beta-pleated sheet structure. It was identified in both the amyloid plaque core and in cerebral vascular amyloid to have an identical 28-amino acid sequence. A cDNA for the beta protein has proved that it is derived from a larger protein expressed in a variety of tissues. There is evidence suggesting that Alzheimer disease is not restricted to the brain. The accumulation of amyloid beta protein in nonneuronal tissues appears to be a widespread disorder. (Joachim, Mori and Selkoe, 1989) The AGER protein, called RAGE (receptor for advanced glycation end products) is an important receptor for the amyloid beta peptide. The expression of this receptor increases in Alzheimer disease. Expression of RAGE is increased in neurons close to deposits of amyloid beta peptide and to neurofibrillary tangles (Yan et al., 1996). It appears that the loss of this major class of neurons, cholinergic neurons, and the cholinergic blockade causes impairment in learning and memory (Gozes, 1996). The neuropathologic hallmark of Alzheimer is the neurofibrillary tangle, the synapse and cell loss (Hardy, 1997). This neurofibrillary tangle is composed of the microtubule-associated protein tau. Tau is found hyperphosphorylated. The phosphorylation of tau destroys its function of binding microtubules and promoting their assembly. This depletion causes communication between nerve cells to be disrupted which causes mitotic abortion and apoptotic cell death and subsequent neuronal death (Lu et al, 1999). In this paper, the effect of A2M is explored. A2M is though to be contribute to the expression of Alzheimer due to its ability to mediate the clearance and degradation of A-beta, which is the major component of beta-amyloid deposits (Kan et al, 1985).Recently, it has been suggested that the typical clinical picture of Alzheimer disease is sufficiently characteristic that diagnosis can be considered one of inclusion rather than exclusion for 90% of patients (Alzheimer Forum, 2000). However, a recent study showed that in community hospitals the accuracy of diagnosis might be significantly lower (Alzheimer Forum, 2000). The typical picture of an Alzheimer patient involves a progressive decline in memory function, accompanied by a gradual retreat from, and frustration with, normal activities. Moreover, numerous clinical signs have been described and all of these occur more than 10% of the time: apathy, agitation, aggression (verbal, physical), anxiety, sleep disturbance, irritability, dysphoria, aberrant motor behavior, disinhibition, social withdrawal, decreased appetite, and hallucinations (visual, auditory, tactile, olfactory) (Alzheimer Forum, 2000).The clinical traits/ histories that might lead one away from the diagnosis of pure Alzheimer disease include extremely rapid onset (from normal function to incapacitated function in less than three years) or early onset (before age 55), preponderance of movement symptoms (Parkinson`s/Lewy Body diseases, Huntington`s disease, or more rare diseases), the presence of eye movement difficulty (progressive supranuclear palsy, multiple sclerosis, Wernicke`s), reports of temporary blindness, widely fluctuating symptoms, or focal neurological signs (cerebrovascular disease), history of alcoholism (Korsakoff psychosis) or drug abuse (drug-induced delirium), history of AIDS (AIDS dementia), and other important historical information including depression, psychosis, head trauma, seizures, diabetes, neurosyphilis, vasculitis, and tumors (Alzheimer Forum, 2000).


GENETIC BASIS ALPHA-2-MACROGLOBULIN (A2M)
The pattern of inheritance is autosomal dominance with no maternal effect (Masters et al., 1981). According to Xia et al. (1997), Alzheimer disease is genetically heterogeneous. Causative mutations or polymorphisms have been identified in four different genes, with additional loci to be discovered soon. The main issue of these polymorphisms involves whether or not they operate through a common pathogenic mechanism (Xia et al., 1997).There have been many studies to map the A2M disease gene to its particular chromosomal location: 1. Electoimmunoassay was performed on a 37-year old man, his mother and one daughter. A2M was found to be deficient. A2M is a protease inhibitor. It inhibits many proteases, including trypsin, thrombin and collagenase (Kan et al., 1985). The deficient family members were heterozygotes. An alternation involving 10 restriction sites detected with 10 different enzymes was that to have caused by major deletion or rearrangement in the gene (Kan et al., 1985). A2M is a serum pan-protease inhibitor, and has been implicated in Alzheimer disease based on its ability to mediate the clearance and degradation of A-beta, the major component of amyloid beta deposits. The deletion in the A2M gene was analyzed at the 5 prime splice site of ‘exon II’ of the bait region (exon 18) and found that inheritance of the deletion, designated A2M-2, conferred to an increased risk of Alzheimer disease (OMIM, 2000).2. The A2M gene was demonstrated to span approximately 48 kb and has 36 exons, from 21 to 221 bp in size with consensus splice sites. Intron sizes range from 125 bp to 7.5 kb. The A2M gene is present in single copy in the haploid genome (OMIM, 2000).3. A2M was assigned to chromosome 12 by a Southern blot analysis of DNA from a panel of mouse/human somatic cell hybrids, using A2M cDNA as a hybridization probe. The A2M locus was assigned as: 12p13.3-p12.2 and confirmed by use of in situ hybridization and somatic cell hybrid DNA analysis (OMIM, 2000).The A2M gene was isolated and studied by molecular cloning and DNA sequencing:1. A2M cDNA clones were isolated from a human liver cDNA library by using synthetic oligonucleotides as hybridization probes (OMIM, 2000).2. Cloning includes primers: Left = gggtttctatgtgattattaagctg Right = caggaaggaatccaaatgtagc Product length = 125 (OMIM, 2000).3. Radiation Hybrid Mapping Information includes position 100.86 cR from top of Chr 12 linkage group. cDNA ID: T70551. Description: yd15c01.s1 Homo sapiens cDNA clone 108288 3 similar to gb: A22287 ALPHA (OMIM, 2000).4. mRNA ID: NM_000014. Product: A2M precursor. Protein sequence PID: g4557225 (OMIM, 2000).5. Human tissues used in cloning procedures: stomach, testis, thyroid, uterus, whole embryo, breast, colon, colon_normal, head_neck, skin, stomach, and thymus, pooled (OMIM, 2000).6. Direct sequencing of the two alpha 2M functional domain is a useful tool for the detection of the genetic, and possible the functional, heterogeneity of alpha 2M. This, in turn, may provide insight into the unknown physiological role(s) of alpha 2M, by studying in vivo effects of naturally occurring mutations of the gene (OMIM, 2000).7. DNA sequencing: Overlapping genomic clones were isolated from a cosmid library and used to map 80 kb of the chromosomal region of the gene, A2M. Fragments carrying the two exons encoding the bait region and the exon encoding the thiolester site were partially sequenced and PCR primers were designed for the amplification of both domains. The first was a sequence of polymorphism (OMIM, 2000).

Antibody: IgM, Protein ID: 177870, Protein Precursor: NP_000005, Nucleotide ID: M11313 (OMIM, 2000).Structure of the gene at the DNA sequence level and diagram gene: 231 bp. Intron 1…100/number = 17 Exon 101…215/number = 18 Intron 216…230/number=18 1 tttgtttttt gttttttttt tttttggtgg caactattac attctctcat aagctttatc 61 tgtatgttta ttgtaatgtc ttcttcctca ctcaccatag agtcagatgt aatgggaaga 121 ggccatgcac gcctggtgca tgttgaagag cctcacacgg agaccgtacg aaagtacttc 181 cctgagacat ggatctggga tttggtggtg gtaaagtaag taacttcctg c :------------------------Intron--------------------: :------Intron------: :------:-----------:-----------:-----------:-----------:-----------:-----------:-----------:----------:---------:---------:-----------:-------------: 1 25 50 100 150 175 200 225 231 :----------------------------Exon----------------------------: tttgtttttt gttttttttt tttttggtgg caactattac attctctcat aagctttatc tgtatgttta ttgtaatgtc ttcttcctca caccatag^ 1…100 Intron Number = 17 ^agtcagatgt aatgggaaga ggccatgcac gcctggtgca tgttgaagag cctcacacgg agaccgtacg aaagtacttc cctgagacat gatctggga tttgg ^ 101…215 Exon Number = 18 (If this is not produced then A2M-2 mutation occurs and proteins acculmulate) ^tggtg gtaaagtaag taacttcctg c 216…231 Intron Number = 18Structure of the Inhibitory RNA Stem Loop at the 5’ Boundary of the Intron (Alzheimer Forum, 2000).



GENE EXPRESSION
The gene, A2M, involves a deletion polymorphism at a 5-prime splice site deletion in exon 18. The exon encodes ‘exon II’ of the bait domain of the A2M, which functions to attract and trap proteases. This change in A2M, referred to as, A2M-2, increases the risk of AD (OMIM, 2000).As cited by OMIM, 2000, There is evidence of mutations in at least four genes which can cause Alzheimer disease: AD1 is caused by mutations in the amyloid precursor gene, AD2 is correlated with the APOE 4 allele on Chromosome 19, AD3 is a mutation in a chromosome 14 gene encoding a 7-transmembrane domain protein, presenilin-1, and AD4 is caused by mutation in a gene on chromosome 1 that encodes a similar 7-transmembrane domain protein, presenilin-2. There is evidence of other Alzheimer disease loci on other chromosomes and the expression of mitochondrial DNA polymorphisms. The particular expression between a polymorphism in alpha-2-macroglobulin with low-density lipoprotein-1, is the receptor for A2M, APOE and APP. Therefore it is expected for all four of these proteins: A2M, LRP1, APOE and APP may join in a common neuropathogenic pathway leading to Alzheimer disease-related neurogeneration (OMIM, 2000).


DETECTION/TREATMENT/CURE
As cited by Alzheimer Forum (2000), there are several tests which are evaluated to exclude diseases and/or deficiencies which are treatable. This involves taking a blood sample from the patient and testing for hormones, vitamins, blood cell count, and other factors which could in deficiency (usually) or in excess (occasionally) lead to dementia (Alzheimer Forum, 2000).The following Genetic diagnostics for Alzheimer disease are still in their infancy as reported by Alzheimer Forum (2000). In the foreseeable future, a means of testing every known genetic foci of Alzheimer disease is anticipated. In the meantime, there are several tests that can be performed: 1. Apolipoprotein E allele typing. This is the only type of genetic test for Alzheimer disease that is currently available commercially. There are three common ApoE alleles: ApoE e2, e3, e4. People with ApoE e4 alleles have an increased chance of developing Alzheimer disease symptoms, relative to those with the e3 or, to an even greater degree, the e2 alleles. A patient is five times more likely to develop the disease if the e4 allele is present. However, by the age of 80, e4 carriers still have only ~50% chance of developing the disease. Hence, the ApoE allele typing diagnostic is not predictive, but only indicates the degree of risk. There is evidence that ApoE alleles can help predict a patient’s likelihood of response to anticholinesterase (e.g. Cognex, Aricept) medication. It is currently recommended only to help support a diagnosis of Alzheimer disease, and not to predict Alzheimer disease risk among family members (Alzheimer Forum, 2000). 2. Other genetic tests. There are many other genes that have been reported to confer vulnerability to Alzheimer disease in some patients. Early-onset familial Alzheimer disease (FAD) has been linked to the genes for amyloid precursor protein (APP), presenilin-1 (PS1) and presenilin-2 (PS2). Athena Neurosciences offers a commercial test for PS1 mutations, which account for roughly 10% of AD cases (Alzheimer Forum, 2000). APP and PS2 mutations are very rare and there is at present no commercially available test. A patient whose family has a strong history of early onset Alzheimer disease (and has tested negative for PS1 mutations) could contact a laboratory that analyzes Alzheimer genealogies for research. More systematic means of testing Alzheimer genes may eventually become available (Alzheimer Forum, 2000). Structural radiography. Magnetic resonance imaging (MRI) can reveal brain tissue loss patterns characteristic of Alzheimer disease, and is seen as a useful adjunct to standard methods. MRI can help to differentiate Alzheimer disease cases from other types of dementia, particularly frontal lobe dementia. Recent MRI studies confirm postmortem findings of marked neuronal loss in specific areas of the entorhinal cortex at the earliest stages of Alzheimer disease (Alzheimer Forum, 2000). It seems likely that this type of MRI diagnostics will become an important tool for identifying individuals who can benefit from therapies to delay or prevent the progression of the disease. Such tests should become available at any large hospital with high-resolution MRI capabilities (Alzheimer Forum, 2000). Functional radiography: Radiological tools that detect focal hypometabolism in the brain have shown promising results, and are increasingly seen as useful adjuncts in the differential diagnosis of Alzheimer disease (Alzheimer Forum, 2000). These tests involve somewhat invasive techniques (such as injecting a low-level radioisotope into the blood) that are also expensive, although not more so than full-battery neuropsychological testing. PET (positron emission tomography) and SPECT (single photon emission computed tomography) are available at any hospital with a nuclear medicine division (Alzheimer Forum, 2000). Functional MRI has the advantage of being noninvasive, but is still a research tool and not widely available. Some of these tests are commercially available, but controversies remain regarding their sensitivity and specificity in Alzheimer disease diagnosis. They may be helpful for confirming a diagnosis (Alzheimer Forum, 2000). 1. Tests in which Tau protein is assayed. It is probably the best cerebral spinal fluid (CSF) assayable diagnostic test to date. Tau protein quantitation in CSF reveals elevated levels in most Alzheimer disease cases, including early in the course of the disease. However, there are causes of dementia other than Alzheimer disease that also involves elevated CSF Tau protein (especially Diffuse Lewy Body Disease, multi-infarct dementia, and frontotemporal dementia). As with other tests, the level of Tau protein may increase as the disease progresses, rendering the test more accurate later in the disease progression (Alzheimer Forum, 2000). 2. Tests in which AD7C-NTP-immunoreactive protein is assayed (Alzheimer Forum, 2000). AD7C-NTP is a molecule whose cDNA was recently cloned; it is apparently a membrane-spanning molecule in brain that has the properties of a receptor protein. Its expression pattern is predominantly neuronal and is upregulated in AD brain (roughly correlated with antemortem degree of dementia). The AD7C-NTP levels in CSF are elevated, overall, in Alzheimer disease patients vs. aged control (~x4), Parkinsons (~x3), and multiple sclerosis (~x5) patients’ CSF (Alzheimer Forum, 2000). There is some overlap between the cohorts. However, 60-90 % of Alzheimer disease patients had levels higher than any of the controls (including the neurologically-affected controls) (Alzheimer Forum, 2000). The test is very recent and its validity has yet to be established in large-scale studies including postmortem confirmation of the diagnosis. A company called Nymox is attempting to market a commercial test for AD7C-NTP (Alzheimer Forum, 2000). 3. Tests in which the beta-amyloid peptide is assayed. This one is less sensitive and specific in comparison to the above test. Other than genetic tests, tests that involve blood samples have yet to catch on. However, some have been described. These are still experimental (Alzheimer Forum, 2000). The advent genetic counseling and positron emission tomography may soon produce the key to early diagnosis (Gozes, 1996).Treatment isn’t wide ranging. Intranasal deposition of a fatty neuropeptide is a new possibility being explored (Gozes, 1996). It has been suggested that a major neuropeptide, vasoactive intestinal peptide (VIP) is neuroprotective and plays a role in learning and memory. A synthesized VIP has been produced and therapeutically induced into patients. There was loss of impairment of learning and memory as created by cholinergic blockage. This therapy has become an interesting strategy in treating Alzheimer disease especially with the noninvasive delivery of the VIP (Gozes, 1996). It is indeed remarkable that the VIP remains virtually intact in this delivery which helps solve the dilemma of crossing the blood-brain barrier which is a limiting factor in so many treatments. As cited in Gozes (1996), there is also interesting research in the correlation between VIP, Alzheimer disease and the REM sleep mode. It appears that VIP induces REM sleep. This is important in that there has been suggestion that memory loss in Alzheimer may be due to REM sleep deficits or malfunction. Apparently, waking induces the collection of VIP in the cerebrospinal fluid which in turn induces REM sleep (Gozes, 1996).Another drug includes Ethylcholine aziridium (AF64A) is a blocker of choline uptake. This drug in administered by intracerbroventricular delivery (Gozes, 1996). AF64A has been evidenced to cause the ceasement of the neurodegenerative progress in the basal forebrain (Gozes, 1996).As quoted by Hardy (1997), the available data on Alzheimer disease, in general, would suggest that similar increases in amyloid protein may occur in a proportion with the “typical” cases, however, other mechanisms (such as decrease clearance of amyloid deposits) also may play a pathogenic role in some cases. This is important not only from a scientific perspective, but also because it leads to the suggestion that therapies aimed at or downstream of amyloid peptide protein processing may have every chance of have application. (p. 2096)


SUMMARY
Alzheimer disease used to be prefaced with the introduction of dementia of unknown causes. This introduction has been changed to Alzheimer disease is caused by several genetic causes and all of these causes are directed to the path of amyloid peptide protein production. Detection of the amyloid peptide protein deposition is the key to early disease pathogenesis (Hardy, 1997).


BIBLIOGRAPHY
Alzheimer Research Forum. [Online]. Alzheimer Research Forum. http://www.alzforum.org/. [2000, Oct. 20].Cheng, S.V., Nadeau, J.H., Tanzi, R.E., Watkins, P.C., Jagadesh, J., Taylor, B.A., Haines, J.L., Sacchi, N. and J.F. Gusella. 1988. Proceedings of the National Academy of Science USA 85:6032-6036

Cohen, M.L., Golde, T.E., Usiak, M.F., Younkin, L.H. and S.G. Younkin. 1988. In Situ Hybridization of Nucleus Basalis Neurons Show Increased Beta-Amyloid mRNA in Alzheimer Disease. Proceedings of the National Academy of Science USA 85:1227-1231

Corder, E.H., et al. 1993. Gene Dose of Apolipoprotein E Type 4 Allele and the Risk of Alzheimer’s Disease in Late Onset Families. Science 261(5123): 921-923

Dewji, N.N. and S.J. Singer. 1997 Cell Surface Expression of the Alzheimer Disease-Related Presenilin Proteins.Proceedings of the National Academy of Science USA 94:9926-9931

Gozes, I., Bardea, A., Reshef, A., Zamostiano, R., Zhukovsky, S., Rubinrat, S., Fidkin, M. and D.E. Brenneman. 1996. Neuroprotective Strategy for Alzheimer Disease: Intranasal Administration of a Fatty Neuropeptide. Neurobiology 93:427-432

Hardy, J. The Alzheimer Family of Diseases: Many Etiologies, One Pathogenesis? Proceedings of the National Academy of Science USA 94:2095-2097

Hardy, J. and Gwinn-Hardy, K. 1998. Genetic Classification of Primary Neurodegenerative Disease. Science. 282(5391): 1075-1079

Kan, C.C., Solomon, E., Belt, K.T., Chain, A.C., Hiorns, L.R> and G. Fey. 1985 Nucleotide sequence of cDNA Encoding Human Alpha 2-Macroglobulin and Assignment of the Chromosomal Loci. Proceedings of the National Academy of Science U.S.A. 82(8):2282-2286

Kang, J., Lemaire, H.G., Unterbeck, A., Salbaum, J.M., Masters, C.L., Grzeschink, K.H., Multhaup, G., Beyreuther, K. and B. Muller-Hill. 1987. The Precursor of Alzheimer’s Disease Amyloid A4 Protein Resembles a Cell-Surface Receptor. Nature 325:733-736

Kitaguchi, N., Takahashi, Y., Tokushima, Y., Shiojiri, S. and H. Ito. 1988. Novel Precursor of Alzheimer’s Disease Amyloid Protein Shows Protease Inhibitory Activity. Nature 331:530-532

Joachim, C.L., Mori, H. and D.J. Selkoe. 1989. Amyloid beta-protein Deposition in Tissues other than Brain Alzheimer’s Disease. Nature 341:226-230

Lu, P.J., Wulf, G., Zhou, X.Z., Davies, P. and K.P. Lu. 1999. The Prolyl Isomerase Pin1 Restores the Function of Alzheimer-Associated Phophorylated Tau Protein. Nature 399:784-788

Master, C.L., Gajdusek, D.C. and C.J. Gibbs, Jr. 1981. The Familial Occurrence of Creutzfeldt-Jakob Disease and Alzheimer’s Disease. Brain 104:535-558Online Mendelian Inheritance in Man, OMIM (TM). Johns Hopkins University, Baltimore, MD. MIM Number: 104300. Date last edit: 2/28/00 http://www.ncbi.nlm.nih.gov/omim/. [2000, Apr.10].Post, S.G., Whitehouse, P.J., Binstock, R.H., Bird, T.D., Eckert, S.K., Farrer, L.A., Fleck, L.M., Gaines, A.D., Juengst, E.T., Karlinsky, H., Miles, S., Murray, T.H., Quaid, K.A., Relkin, N.R., Roses, A.D., St. George-Hyslop, P.H., Sachs, G.A., Steinbock, B., Truschke, E.F. and A.B. Zinn. 1997. The Clinical Introduction of Genetic Testing for Alzheimer Disease, An Ethical Perspective. Journal American Medical Association 277(10):838-836

Rogaev E.I., Sherrington, R., Rogaeva, E.V., Levesque, G., Ikeda, M., Liang, Y., Chi, H., Lin, C., Holman, K. and T. Tsuda. 1995. Familial Alzheimer’s Disease in Kindreds with Missense Mutations in a Gene on Chromosome 1 Related to the Alzheimer’s Disease Type 3 Gene. Nature 376(6543): 775-558

Tomita ,K, Maruyama, K., Saido, T.C., Kume, H., Shinozaki, K., Tokuhiro, S., Capell, A., Walter, J., Grunberg, J., Haass, C., Iwatsubo, T. and K. Obata. 1997. The Presenilin 2 Mutation (N141I) Linked to Familial Alzheimer Disease Increases the Secretion of Amyloid Beta Protein Ending at the 42nd or 43rd Residue. Proceedings of the National Academy of Science USA 94(5):2025-2030

Terry, R.D. and P. Davies. 1980. Dementia of the Alzheimer Type. Annual Review of Neuroscience 3:77-95

Van Leuven, F., et al. 1998. Strategy to Sequence the 89 Exons of the Human LRP1 Gene Coding for the Lipoprotein Receptor Related Protein: Identification of One Expressed Mutation among 48 Polymorphisms. Genomics. 52(2): 138-144

Wolozin, B., Sicutella, A. and P. Davies. 1988. Reexpression of a Development Regulated Antigen in Down Syndrome and Alzheiver Disease. Proceedings of the National Academy of Science USA 85:6202-6206

Xia, W., Zhang, J., Perez, R., Koo, E.H. and D.J. Selkoe. 1997. Interaction between Amyloid Precursor Protein and Presenilins in Mammalian Cells: Implications for the Pathogenesis of Alzheimer Disease. Neurobiology 94:8208-8213

Xu, C.J., Kanfer, J.N., Klunk, W.E., Xiong, Q., McClure, R.J. and J.W. Pettegrew. 1997. Effect of Phosphomoneoesters, Phosphodiesters, and Phosphocreatine on Glutamate Uptake by Synaptic Vesicles. Molecular Chemical Neuropathology. 32(1-3): 89-99

Yan, S.D., Chen, X., Fu, J., Chen, M., Zhu, H., Roher, A., Slattery, T., Zhao, L., Nagashima, M., Morser, J., Migheli, A., Nawroth, P., Stern, D. and A.M. Schmidt. 1996 RAGE and Amyloid-Beta Peptide Neurotoxicity in Alzheimer’s Disease. Nature 382:685-691

Wisniewski, H.M., Vorbrodt, A.W., Wegiel, J., Morys, J. and A.S. Lossinsky. 1990. Ultrastructure of the Cells Forming Amyloid Fibers in Alzheimer Disease and Scrapie. American Journal of Genetics 7:287-297

Submitted 4/29/00 11:22:30 PM
Last Edited 4/30/00 12:47:08 AM
Converted to New Site 03/09/2009

Rated by 0 users. Users who logon can rate manuscripts and write reviews.

© 2012 National Undergraduate Research Clearinghouse. All rights reserved. The National Undergraduate Research Clearinghouse is not responsible for the content posted on this site. If you discover material that violates copyright law, please notify the administrator. This site receives money through the Google AdSense program when users are directed to useful commercial sites. We do not encourage or condone clicking on the displayed ads unless you have a legitimate interest in the advertisement.