The Genetic Disease Phenylketonuria
Sponsored by Missouri Western State University Sponsored by a grant from the National Science Foundation DUE-97-51113
Home |
The proper APA Style reference for this manuscript is:
PRICE, M. G. (2000). The Genetic Disease Phenylketonuria. National Undergraduate Research Clearinghouse, 3. Available online at http://www.webclearinghouse.net/volume/. Retrieved February 5, 2012 .

The Genetic Disease Phenylketonuria
MELISSA G. PRICE
-NONE- DEPARTMENT OF BIOLOGY

Sponsored by: TODD ECKDAHL (eckdahl@missouriwestern.edu)
ABSTRACT
Phenylketonuria is an autosomal recessive Phenylketonuria is a genetic disorder that was first discovered in 1934 by Dr. Asbjorn Folling of Norway. It can cause severe mental retardation in children that are not treated. The main treatment for PKU is a low phenylalanine diet. The location of the gene is 12q22-q24.1. There have been many experimental studies done on this disease and most of the tests to find the mutations have been run on mice. Phenyalanine hydroxylase is the disease gene, and there are approximately 70 mutations that cause PKU.

Dr. Asbjorn Folling discovered phenylketonuria in 1934. Folling discovered PKU when a mother with two severely mentally retarded children came to him because she wanted an explanation for why her children were handicapped. After many hours of observation of the children and many tests, Dr. Folling found that their urine samples showed no protein or glucose. Then when he added ferric chloride to the urine, which was used to detect ketones in the urine of diabetics, it turned deep green. This reaction had never happened before, the urine usually stayed brownish or it would turn purple or burgundy. After extensive tests Folling concluded that the two children excreted phenylpyruvic acid in their urine, whereas, normal people did not (10). Later, in 1947 Jervis localized the metabolic error as the inability to oxidize phenylalanine to tyrosine. Jervis also demonstrated the deficiency of phenylalanine hydrozylase in the liver of a patient in 1953 (14). People who have phenylketonuria are unable to convert the amino acid phenylalanine to the amino acid tyrosine. The only difference between phenylalanine and tyrosine is a hydroxyl group on the tyrosine. Phenylalanine hydroxylase is an enzyme that catalyzes the reaction, but this enzyme is not active in individuals with the disease. This enzyme functions in the liver. Phenylalanine accumulates and could possibly be converted to phenylpyruvic acid. Phenylpyruvic acid is not efficiently absorbed by the kidney, therefore it spills into the urine. Both the phenylalanine and the phenylpyruvic acid enter the cerebrospinal fluid and result in elevated levels in the brain. This is what causes the mental retardation. Some other phenotypes of PKU include the following: organ damage; unusual posture; `mousy` odor; light pigmentation; and epilepsy (14). The diagnosis of PKU is carried out by the Guthrie test. This detects elevated levels of phenylpyruvic acid in the blood during the first week of life. This is done with a needle prick in the heel and the blood is dried on filter paper so that the phenylalanine concentration can be measured. PKU must be detected early so that treatment can start within the first 20 days of life. PKU screening of a newborn can prevent retardation, because the child can be put on a low-phenylalanine diet. The low-phenlalanine diet helps to prevent phenlypyruvic acid build-up. Strict dietary management of the mother with PKU during pregnancy also helps prevent the disease. The diet should contain 100 to 200 mg/kg/day of tyrosine and 2g/kg/day of protein; this should be eaten relatively evenly throughout the day. A half of century ago, scientists discovered that the neurological risks of PKU could be avoided if children adhere to a diet devoid of meat, fish, dairy products, breads, nuts, and many other foods. Keeping this diet is difficult and PKU children must take a food additive in order to get enough protein (1).Figure 1-1

Figure 1-2 Phenylketonuria is inherited in a strictly autosomal recessive manner. PKU is an inherited error of metabolism caused by a deficiency in the enzyme phenylalanine hydroxylase. Most of the variation in PKU is because of heterogeneity in the mutant alleles. PKU is caused by mutations in both alleles of the gene for phenylalanine hydroxylase (PAH), found on chromosome 12. The PAH locus being on chromosome 12 was found using a cDNA probe. Later the PAH locus was assigned to 12q21-qter by restriction enzyme analysis of DNA from human-hamster somatic cell hybrids. By "in situ hybridization," the assignment of the PAH locus was assigned to 12q22-q24.1 (14). In 1987 the PAH gene was localized to a mouse chromosome 10 by in situ hybridization. McDonald, Justice, and Shimizu also mapped the PAH gene to chromosome 10 of a mouse. McDonald used linkage mapping to demonstrate that a disorder that the mouse had which had characteristics close to those of PKU were mapped on chromosome 10 (14). Then in 1997 McDonald and Charlton identified a mutation within the protein coding sequence for the PAH gene in each of the two genetic mouse models that they were using for human PKU. They found that the enu 1 mutation, which was induced by a chemical mutagen called N-ethyl-N-nitrosourea, predicts a conservative valine-to-alanine amino acid substitution and is located in exon 3. The second ENU induced mutation predicts a radical phenylalanine-serine substitution and is located in exon 7 (14). According to Guttler and Woo in 1986 the PAH gene was 90kb long and codes for a mature mRNA of 2.4kb. Guttler and Woo also reviewed the molecular genetics of PKU. Their cDNA probe of human phenylalanine hydroxylase recognized 10 polymorphic cleavage sites for restriction enzymes (14). In 1991 Kalaydjieva found 3 silent mutations in the PAH gene, in codons 232, 245, and 385. All 3 mutations created a new restriction site and were easily detected on PCR-amplified DNA (14). Finally, in 1999 after testing the activity of the mutant gene products from 11 PAH-deficient patients. Benit found two mutations, ala259 to val and leu333 to phe. These mutations marked reduced PAH activity (14). There are many mutations in PKU, however only a few will be discussed. The most common mutation is found at the exon 12 donor splice site, this is referred to as IVS12DS, G-A, +1. This causes skipping of the 12th exon when RNA is being spliced. This mutation occurs because of the single base substitution GT to AT. The next mutation is caused by a transition from CGG to TGG also in exon 12. This mutation will result in an amino acid substitution of Arg to Trp at position 408 in the PAH gene. The third mutation is a substitution of Arg 261 to Gln in exon 5. Another mutation is the substitution from G to A in the Arg 158 position. This causes the amino acid to be replaced by Gln. The fifth and final mutation to be discussed was shown by molecular cloning and DNA sequencing, the variation was a T-to-C transition in exon 9, which resulted in a substitution of Pro for Leu 311 (14).The following table shows the DNA sequence for the PAH gene.Table 1-1Phenylalanine Hydroxylase gene; Phenylketonuria; The PAH gene has 13 exons / all exons are translated; Based on Genbank Accession Numbers:;

5UTR E0001 accttcagccccacgtgctgtttgc/AAACCTGCCTGTACCTGAGGCCCT; AGACCTCACTCCCGGGGAGCCAGC[ATG]TCCACTGCGGTCCTGGAAAAC E0001 I0001 GAAACTCTCTGACTTTGGACAGgtgagccacggcagcctgagctgct I0001 E0002 taaacaaatgcatcttatcctgtagGAAACAAGCTATATTGAAGACAAC E0002 I0002 CAAAGTATTGCGCTTATTTGAGgtcagtgctacaatcatgtttgtc I0002 E0003 tcaccctccccattctctcgtctagGAGAATGATGTAAACCTGACCCA E0003 I0003 CGAGATAAGAAGAAAGACACA[Ggtaagaattagaggaattttgcaac I0003 E0004 aggacgttgccttctctgtgtttcagTG]CCCTGGTTCCCAAGAACCAT E0004 I0004 CGGAACTGGATGCTGACCACCCTgtgagtccatggcccgtagatgag I0004 E0005 gaaaaatcaggtgtctcttttctcctagGGTTTTAAAGATCCTGTGTACC E0005 I0005 ACATTGCCTACAACTACCGC[CagtaagtctgccttgcttgttgaggggaI0005 E0006 acctattttgtgcctgtattctagT]GGGCAGCCCATCCCTCGAGTG E0006 I0006 GACGTTTCTCAATTCCTGCAG[Agtaagtccacatcagggtcaatgccct I0006 E0007 agttttctttcttcttttcatcccagCT]TGCACTGGTTTCCGCCTCCGA E0007 I0007 AGCCCATGTATACCCCCGAA[CCgtgagtactgtcctccagctaccag I0007 E0008 ctctctgtgctttctgtctttcagT]GACATCTGCCATGAGCTGTTG E0008 I0008 CAGCTTTGCCCAGTTTTCCCAGgtaaggaatgga(t)6agccttctagtt I0008 E0009 aggttctattttcccccaattacagGAAATTGGCCTTGCCTCTCTGGGTE0009 I0009 ATACATTGAAAAGCTCGCCACAgtaagtcccttctctccctgggtgI0009 E0010 tctcagattgactttccattccagATTTACTGGTTTACTGTGGAGTE0010 I0010 GTCATCCTTTGGTGAATTACAGgtatgaccttcacaggaaccaaggaI0010 E0011 taacttttcacttggggcctacagTACTGCTTATCAGAGAAGCCAAAGE0011 I0011 ATGATGCCAAGGAGAAAGTA[AggtgaggtggtgacaaaggtgagccaI0011 E0012 tcaagcctgtggttttggtcttagG]AACTTTGCTGCCACAATACCTE0012 I0012 ATTTTGGCTGATTCCATTAAC[AgtaagtaatttacaccttacgaggccaI0012 E0013 gcccattttgatggtgtttttctttgtagGT]GAAATTGGAATCCTTTGCAGE0013 3UTR GTGCCCTCCAGAAAATAAAG[TAA]AGCCATGGACAGAATGTGGTCTGT

The treatment of PKU is by reducing the amount of phenylalanine in the diet so that the body has just enough phenylalanine for growth and tissue repair, but no more. Protein foods must be severely restricted, because all protein foods are high in phenylalanine. However, everyone needs some protein. Protein substitutes have little or no phenylalanine in them so they provide the protein that the PKU patient needs. The protein substitute contains some extra tyrosine and all of the other amino acids needed for normal growth. Also, according to Edwin W. Brown in the article called Dietary Management of PKU, he stated that, "It may soon be possible to treat PKU by enzyme therapy. Scientists in Canada have made recombinant phenylalanine ammonia lyase (PAL), a robust enzyme able to degrade phenylalanine(7)." When PAL was injected into animals it reduce the blood phenylalanine values (7). Couples should have genetic tests to see if they are carriers of the recessive gene for PKU. If they are then they should definitely take that into account if they decide to have children. I know that I would want to know the chances of my children have the genetic disease phenylketonuria, because I could take the necessary precautions while I was pregnant. After all, children born with PKU can lead normal lives and mothers who have the disease can produce healthy children, with dietary supervision.

Submitted 5/1/00 9:54:55 AM
Last Edited 5/1/00 9:57:06 AM
Converted to New Site 03/09/2009

Rated by 0 users. Users who logon can rate manuscripts and write reviews.

© 2012 National Undergraduate Research Clearinghouse. All rights reserved. The National Undergraduate Research Clearinghouse is not responsible for the content posted on this site. If you discover material that violates copyright law, please notify the administrator. This site receives money through the Google AdSense program when users are directed to useful commercial sites. We do not encourage or condone clicking on the displayed ads unless you have a legitimate interest in the advertisement.